Introduction 2006 PR PR1 PR1 NtPR1a, b c NtPRB1 PR-1g NtPRB1b Nicotiana tabacum 1999 PR1 PR1 Arabidopsis Oryza sativa Arabidopsis PR1 Tobacco mosaic virus 2006 PR1 PR1 2006 PR1 Arabidopsis PR1 OsPR1a 1b 2001 2000a PR1 1997 2007 PR1 2006 PR1 PR1 Arabidopsis PR1 OsPR1 β-glucuronidase GUS PR1 PR PR Materials and methods Plant materials Oryza sativa 1988 R Pi-i Magnaporthe grisea 1976 OsPR1::GUS −1  Infection with pathogens Magneporthe grisea 5 −1 Xanthomonas oryzae pv. oryzae (Xoo) 8 Xoo Treatment with chemicals Plastic pots (15 × 5.5 × 10 cm) with 12 rice seedlings at the 4-leaf stage, were dipped in 500 ml solutions containing 1 mM 1-aminocyclopropane-1-carboxylic acid (ACC) or 3 mM sodium salicylate (SA) solution, and incubated for 24 h in the greenhouse. For jasmonic acid (JA) treatment, pots with 12 seedlings each was put in an air-tight clear plastic box, and a cotton pad with volatile methyl jasmonate (MeJA) dissolved in EtOH was put at the corner of the box to give a final concentration of 100 μM, and incubated for 24 h. The fourth leaves were used for RNA extraction. Quantitative real-time RT-PCR OsPR1 2 actin Construction of plasmids for transformation of rice OsPR1.1 OsPR1#074 TM 2007 Not Bam PR1T::GUS 7 PR1T::GUS OsPR1 2007 Transformation of rice Agrobacterium tumefaciens 2007 2006 Histological GUS analysis 1990 Results PR1 1987 Oryza sativa http://www.cdna01.dna.affrc.go.jp/cDNA http://www.riceblast.dna.affrc.go.jp/ http://www.rapdb.dna.affrc.go.jp/ PR1 PR1 2000a 1 OsPR1b OsPR1#011 OsPR1#012 PR1 OsPR1#071 #072 #073 #074 1 OsPR1 Arabidopsis 1 1 Arabidopsis Table 1 PR1 Plant Accession No. (Symbol name) Locus name References PI Proposed symbols Rice OsPR1b Os01g28450 2000b 7.6 OsPR1#011 AK121108 Os01g28500 – 8.7 OsPR1#012 AK107467 Os02g54540 – 8.5 OsPR1#021 AK105575 Os02g54560 – 5.9 OsPR1#022 AK071326 Os05g51660 – 7.1 OsPR1#051 AK100748 Os05g51680 – 5.5 OsPR1#052 AK060057 Os07g03279 – 4.2 OsPR1#071 AK062949 Os07g03580 – 4.7 OsPR1#072 AK063248 Os07g03590 – 5.8 OsPR1#073 OsPR1a) Os07g03710 2000a 4.4 OsPR1#074 AU070895 Os10g11500 – 10.7 OsPR1#101 AK100940 Os12g43700 – 5.1 OsPR1#121 Arabidopsis (PR-1 like) At2g19990 1991 6.0  (AtPRB1) At2g14580 2001 8.8  Tobacco NtPR1a)  1987 4.4  (NtPRB1b)  1992 7.6  Fig. 1 PR1 Arabidopsis boxed b pI red, blue, and green a  1 1 1 Arabidopsis Responses of OsPR1 genes to blast-fungus infection in young rice plants Compatible interaction OsPR1 2 M. grisea 2004 2006 actin OsPR1 2 OsPR1 OsPR1#074 #011 #012 OsPR1#073 #022 #101 #051 #121 OsPR1#074 #011 #071 #073 #052 #072 #101 #121 Table 2 OsPR1 actin Name Forward primer Reverse primer OsPR1#074 GTATGCTATGCTACGTGTTTATGC GCAAATACGGCTGACAGTACAG OsPR1#011 ACGCCTTCACGGTCCATAC AAACAGAAAGAAACAGAGGGAGTAC OsPR1#071 CTTTAACTATGTATGGAGTATGATATAAATGTG TTATTTTCTTCTTTTATTCGAACGACAAC OsPR1#012 CGCTGTGTGTTTGTGTTATGTC CGTGGTTTTGTCTTTATTTCAATCC OsPR1#073 TTATATATGTATGTTCGTATGTATGTATGC TGATGTACTTATTCCATCCGACAC OsPR1#021 CGCAGCAACCAACCAATCTTG ACAGTTGTAGTACTCTTGTAACATCATC OsPR1#022 CCACAGAGTTTGTCAGGATTGTC CAGATTGCACACACCTGATTCC OsPR1#052 AGCTACCTGTCATTTCTTCATTTC TGCTACTCCAGAAGGAAATTAAAAG OsPR1#072 AATTAATACTGGAGTAGATGCATGTAC ACGAATAACGTACTGTATTCTGTATG OsPR1#121 ACCATCGTCGTCGTCTCATC AGCCTCTAGGGCATATCACTAAC OsPR1#101 TCGCTGCCGCTAGTACATTTC ATTAAGATCATTACATGCTTTATTGTTCAC OsPR1#051 CCTGCCTGCCTTCCTCATTC AGTGAAGATTTGGTTTCCATTGTATTG Actin GAGTATGATGAGTCGGGTCCAG ACACCAACAATCCCAAACAGAG Fig. 2 OsPR1 a upper panel lower panel dpi actin white, gray, and black columns Bars b Xoo actin white, gray, and black columns Xoo Bars  Incompatible interaction Pi-i 2004 2006 OsPR1#074 #011 #012 2 OsPR1#074 #011 OsPR1#071 #072 #073 #101 OsPR1#121 OsPR1#051 Responses of OsPR1 genes to bacterial blight infection in young rice plants OsPR1 Xoo OsPR1#074 #011 #012 2 2 Xoo OsPR1#021 #022 OsPR1#074 #011 #012 #101 Xoo OsPR1 OsPR1 2 Wound-induced expression of OsPR1 genes in young rice plants OsPR1 OsPR1#074 OsPR1#051 3 OsPR1#121 3 Fig. 3 OsPR1 actin Bars  Fig. 4 OsPR1 right panel actin white and gray arrowheads Bars  Organ specific expression of OsPR1 genes OsPR1#074 #071 #073 #072 #101 4 OsPR1#074 #011 #012 #121 #051 OsPR1 OsPR1#074 #071 #073 #072 OsPR#074 #011 #012 #121 #051 Responses of OsPR1 genes to defense signal compounds in young rice plants OsPR1 5 OsPR1#074 #101 OsPR1#071, #073, #021 #121 OsPR1#074 #011 #012 2 OsPR1#011 OsPR1#074 #051 3 OsPR1#022 #052 OsPR1#011 #072 OsPR1#071 Fig. 5 OsPR1 OsPR1 actin gray, dark gray, and black arrowheads C1 MeJA C2 bars  Arabidopsis OsPR1 PR 1998 PR1 2 3 PR2 5 6 1998 Arabidopsis 2003 PR 1994 OsPR1 5 OsPR1#071 6 r 1988 r r r r n r 6 Fig. 6 OsPR1 5  Tissue specific expression of a representative OsPR1 gene in rice plants PR1 OsPR1 OsPR1#074 OsPR1#074 2007 PR1T::GUS 7 OsPR1T::GUS Oryza sativa M. grisea OsPR1T::GUS Fig. 7 OsPR1#074 a OsPR1#074 b a–e f c a b c–e d a, c, d b Black arrows Brown arrows  7 7 7 7 7 7 OsPR1T::GUS 7 7 OsPR1 7 7 Pi-i 7 7 7 7 7 Discussion OsPR1 PR 1 PR1a b 2001 PR1 2006 PR1 http://www.cdna01.dna.affrc.go.jp/cDNA http://www.riceblast.dna.affrc.go.jp/ PR1 1 Brassica napus Hordeum vulgare Lycopersicon esculentum Medicago trunculata Triticum aestivum Zea mays 1999 OsPR1 OsPR1 2 OsPR1#074 #011 #012 #101 Xoo OsPR1#074 #011 #012 OsPR1#021 #022 Xoo Xoo 3 OsPR1 Arabidopsis PR1 Arabidopsis PR1 2006 http://www.arabidopsis.org/ PR1 Pseudomonas syringae Pytophythora infestans PR1 PR1 Arabidopsis OsPR1 Arabidopsis PR1 1995 2007 1995 2007 Arabidopsis Arabidopsis OsPR1 OsPR1 6 1998 Arabidopsis 2000 1987 NtPRB1b 1992 1998 AtPRB1 2001 Arabidopsis Arabidopsis PR1 OsPR1 OsPR1 8 OsPR1#071 #72 #073 #074 OsPR1#074 OsPR1#071 #072 #073 OsPR1#074 #071 #072 #073 Xoo OsPR1#074 OsPR1#071 #072 #073 OsPR1#074 OsPR1#071 OsPR1#072 OsPR1#073 OsPR1#074 OsPR1#071 #072 #073 Fig. 8 OsPR1 OsPR1 th ++ + ± −  PR1 PR1 OsPR1 PR1a 1993 Phytophythora infestans 1995 OsPR1 7 OsPR1 OsPR1T::GUS OsPR1#074 PR1a::GUS 1998 GUS 7 OsPR1#074 7 OsPR1#074 PR1 PR1