Introduction 2005 1995 1998 2001 2005 2005 1999 2002 2006 2002 2003 2004 2002 2005 2006 2002 2002 2005 2001 2006 2002 2003 2005 2005 2004 2005 2003 2004 2004 2005 2007 2006 2002 2002 2003 2005 2006 2007 2007 2004 2007 in silico 1993 1996 2003 In this study, the development of a DNA microarray is described, demonstrating the suitability of the 16S rRNA gene for designing oligonucleotides as microarray probes to differentiate at least 11 fish species from European seas. Based on these data, a “Fish Chip” for approximately 50 fish species is under construction to support the identification of eggs and larval stages from species that are otherwise difficult to identify, and of adult or processed fishes in fisheries industry. Material and Methods Sampling and DNA Extraction 1 1 Figure 1 NS BB WM CM EM  Table 1 Number of sequences per fish species and sampling region Species Family Order North Sea Bay of Biscay Western Mediterranean Central Mediterranean Eastern Mediterranean EMBL sequence data base and other projects Total Accession number of EMBL data base sequences Target species Boops boops Sparidae Perciformes   3  4 1 8 AF247396 Engraulis encrasicolus Engraulidae Clupeiformes  3 2  1  6  Helicolenus dactylopterus Sebastidae Scorpaeniformes  3 1  6 1 11 AY538975 Lophius budegassa Lophiidae Lophiiformes  3   6  9  Pagellus acarne Sparidae Perciformes  3 3  3  9  Scomber scombrus Scombridae Perciformes  3   1 2 6 AB120717, AF055615 Scophthalmus rhombus Scophthalmidae Pleuronectiformes 3 3 1   1 8 AY359665 Serranus cabrilla Serranidae Perciformes   3  4  7  Sparus aurata Sparidae Perciformes   3  2 1 6 AF247432 Trachurus trachurus Carangidae Perciformes 1  2  5 2 10 AB108498, AB096007 Trigla lyra Triglidae Scorpaeniformes  3   3  6  Additional species Chelidonichthys lucernus Triglidae Scorpaeniformes 1 3   6  10  Diplodus sargus Sparidae Perciformes   2  4  6  Gadus morhua Gadidae Gadiformes 1 2    3 6 X99772, NC_002081, AY850363 Merluccius merluccius Merlucciidae Gadiformes  2 3 3 6  14  Mullus surmuletus Mullidae Perciformes 2 5 2  2  11  Mullus barbatus Mullidae Perciformes   2  5  7  Pagellus erythrinus Sparidae Perciformes  1 2  7  10  Platichthys flesus Pleuronectidae Pleuronectiformes 4 2    4 10 AY359670, AB125255, AY157320, AF113180 Pleuronectes platessa Pleuronectidae Pleuronectiformes 4     2 6 AY359673, AY157328 Psetta maxima Scophthalmidae Pleuronectiformes 1 3     4  Sardina pilchardus Clupeidae Clupeiformes  3 3  4  10  Scorpaena notata Scorpaenidae Scorpaeniformes   5  6  11  Scorpaena porcus Scorpaenidae Scorpaeniformes  3   3 1 7  Serranus hepatus Serranidae Perciformes   2 2 3  7  Solea solea Soleidae Pleuronectiformes 3 3 2   3 11 AB125247, AF488442, AF112845 Zeus faber Zeidae Zeiformes  3 3  2 6 14 NC_003190, AF488474, AF221894-AF221896, AP002941   Σ 230  Accession numbers are given for sequences obtained from EMBL sequence database 2007 Polymerase Chain Reaction and Sequencing A fragment of approximately 1380 bp length from the mitochondrial 16S rRNA gene was amplified with the primer 16fiF140 (5′-CGY AAG GGA AHG CTG AAA-3′), which has a single-base modification compared with Palumbi et al. (1991, unpublished manuscript) as well as with the newly designed primer 16fiR1524 (5′-CCG GTC TGA ACT CAG ATC ACG TAG-3′). Polymerase chain reaction (PCR) reactions with a total volume of 15 μl contained 1.5 μl 10 X reaction buffer, 1.5 μl dNTPs (10 mM), 0.05 μl of each primer (100 pmol/μl), 5 μl DNA-extract, 0.3 μl Teg polymerase (3 U/μl; Prokaria, Reykjavik, Iceland), and 6.6 μl deionized water. Thermal profile began at 94°C for 4 min, followed by 35 cycles of 94°C (30 s), 54°C (30 s), 72°C (90 s), with a final step of 7 min at 72°C. PCR products were purified by using the ExoSAP-IT for PCR clean-up (GE Healthcare, Uppsala, Sweden). The newly designed sequencing primer 16fiseq1463 (5′-TGC ACC ATT AGG ATG TCC TGA TCC AAC-3′) was used to sequence one strand of the amplified fragment using the BigDye Terminator Cycle Sequencing Kit (ver. 3.1, PE Biosystems, Foster City, USA). The sequencing reactions were run in an ABI Prism 3730 automated DNA Analyzer (Applied Biosystems, Foster City, USA) according to the manufacturer’s instructions. Sequence Analysis and Oligonucleotide Probe Design 1 1994 1999 2002 m 1998 1994 in silico Preparation of DNA Microarrays and Hybridisation Experiments 3 4 2 Fig. 2 Layout of the microarray  Taq in silico 2 Table 2 Nontarget species tested in hybridisation experiments Species Family Order Dentex dentex Sparidae Perciformes Diplodus vulgaris Sparidae Perciformes Gadus morhua Gadidae Gadiformes Melanogrammus aeglefinus Gadidae Gadiformes Merlangius merlangus Gadidae Gadiformes Merluccius merluccius Gadidae Gadiformes Micromesistius poutassou Gadidae Gadiformes Mullus surmuletus Mullidae Perciformes Pollachius pollachius Gadidae Gadiformes Pollachius virens Gadidae Gadiformes Psetta maxima Scophthalmidae Pleuronectiformes Serranus hepatus Serranidae Perciformes Trachurus mediterraneus Carangidae Perciformes Trachuru picturatus Carangidae Perciformes Taxonomy according to FishBase (2007) 2 Measurement of Fluorescence Signals and Data Analysis Hybridisation signals were measured using an Axon 4000B fluorescence microarray scanner at 635 nm (Cy5) as well as at 528 nm (Cy3). The fluorescence signal analysis was conducted with the software GenePix 4.1 (Axon, Union City, USA). The fluorescence signals of each probe were measured and the arithmetic mean was calculated. However, data were removed from the analysis if the spots showed artefacts caused during the spotting process (e.g., inhomogeneous spots documented by a monitoring camera during spotting) or experimental artefacts (e.g., air bubbles). Background noise was corrected by subtracting the arithmetic mean of the negative control measurement from the arithmetic mean of the spot measurements. Negative values were set to zero. Results 3 3 1996 Engraulis encrasicolus Sparus aurata Trigla lyra j Boops boops Helicolenus dactylopterus Lophius budegassa Pagellus acarne Scomber scombrus Scophthalmus rhombus Serranus cabrilla Trachurus trachurus l Table 3 Oligonucleotide probes for the identification of fish species from European seas Species name Probe name Probe sequence (5′-3′), 5′-amino-C6-modified Length (bp) m GC (%) Oligo mfe Dimer mfe in silico Boops boops Booboo_315 GCACCACACTCCTAAACCCAAGA 23 82.64 52 ≥0 −0.07 species Engraulis encrasicolus Engenc_213 CAAGTCCTAAATACCCGCAGCCT 23 82.49 52 ≥0 −0.17 species Helicolenus dactylopterus Heldac_317 ACCCCTCCTACAATTAAGAGCCG 23 81.84 52 ≥0 −0.22 species Lophius budegassa Lopbud_312 AACACCCTTCCTATCACCCAGAGCTAC 27 84.39 52 ≥0 −0.2 genus Pagellus acarne Pagaca_317 TACTACACTCCCACATCCGAGAGC 24 82.77 54 ≥0 −0.89 species Scomber scombrus Scosco_321 CAACTACTCCTACAGTCAAGAGCCACC 27 82.91 52 ≥0 −0.43 species Scophthalmus rhombus Scorho_322 CCCCTTAACTCCTCGAAGCAAGA 23 81.88 52 ≥0 −0.37 species Serranus cabrilla Sercab_313 CCATTTTCCTACAACCCAGAGCGAC 25 82.74 52 ≥0 −0.18 species Sparus aurata Spaaur_201 AGAACAGCTCACGTCAAACACCC 23 83.02 52 ≥0 −0.5 species Trachurus trachurus Tratra_333 TTCCTCTCCTCCCACAAGCAAGA 23 83.62 52 ≥0 −0.15 genus Trigla lyra Trilyr_232 AAGACCGAACCAAATGAGCCCTG 23 83.16 52 ≥0 −0.17 family The number in the probe name indicates the binding site in the 16S rDNA sequence Oligo mfe Dimer mfe Values for mfe are given in kcal/mol Fig. 3 Pygoplites nattereri Ortí et al. 1996  4 4 B. boops E. encrasicolus H. dactylopterus L. budegassa S. rhombus S. aurata T. trachurus T. lyra P. acarne S. scombrus S. cabrilla Figure 4 4  Table 4 Target hybridisations Hybridized targets No. of hybridisations Measurements of specific probes Measured probes/absolute no. of probes Mean absolute fluorescence signal in arbitrary units Standard deviation Boops boops 2 21/40 2991 ±1491 Engraulis encrasicolus 2 20/40 1659 ±962 Helicolenus dactylopterus 2 20/40 3502 ±912 Lophius budegassa 2 40/40 3450 ±1515 Pagellus acarne 2 27/40 3727 ±1270 Scophthalmus rhombus 1 15/20 1528 ±269 Scomber scombrus 2 40/40 27827 ±5330 Serranus cabrilla 2 40/40 10814 ±4396 Sparus aurata 2 40/40 963 ±227 Trachurus trachurus 1 20/20 2015 ±880 Trigla lyra 2 35/40 2343 ±560 Merlangius merlangus Merluccius merluccius Dentex dentex Diplodus vulgaris Gadus morhua Melanogrammus aeglefinus Micromesistius poutassou Mullus surmuletus Pollachius pollachius Pollachius virens Psetta maxima Serranus hepatus Trachurus mediterraneus Trachurus picturatus Discussion 2003 2004 2005 2005 2006 2006 1999 2005 1999 2003 1999 3 j l 2005 l Although cross-hybridisations occur, true-positive signals could clearly be differentiated from false-positive signals because of their generally higher signal. Most false-positive signals occurred when the 16S rDNA fragment of nontarget species was hybridised on the microarray. in silico in silico This study shows that the 16S rRNA gene of fishes is suitable to design oligonucleotide probes that are able to differentiate eleven fish species from European seas by single target hybridisation on a microarray. Such a “Fish Chip” can hopefully be applied in marine environmental and fisheries research, as well as in fisheries and food control if the uneven hybridisation signal intensities of the different probe-target pairs can be improved or compensated. 2005 2004 http://www.fishtrace.org http://www.fish-and-chips.uni-bremen.de 2007 http://www.fishbol.org 2005