Introduction Chen et al., 1996 Hackett and Alvarez, 2000 Zhang et al., 1990 Sarmasik et al., 2002 Liu et al., 1990 Higashijima et al., 1997 Hwang et al., 2003 Noh et al., 2003 Gao et al., 1997 Kinoshita et al., 2000 Udvadia and Linney, 2003 Paralichthys olivaceus Aoki et al., 1999 2000 Nam et al., 2000 2003 Hirono et al., 2003 It is possible to generate an effective transgenic fish using tissue-specific or inducible promoters. Indeed, such promoters can regulate foreign gene expression faithfully. In contrast, use of a housekeeping gene promoter would result in nonspecific expression (i.e., overexpression) of foreign genes that may be harmful to the host fish. In this study we developed several Japanese flounder promoters that showed tissue-specific or inducible gene expression with the aim of using these in Japanese flounder. Although we have succeeded in introducing a foreign gene into Japanese flounder fertilized eggs and shown transient expression in Japanese flounder embryos, it has been difficult to conduct promoter assays in vivo because the technology has not been sufficiently developed to produce transgenic Japanese flounder with the necessary efficiency. However, the transgenic zebrafish model system has the advantages of shorter generation time, better optical transparency, and easier treatment schemes when compared with Japanese flounder. In this study, promoter regions of the complement component C3, gelatinase B, keratin and TNF genes were isolated and their promoter activities were characterized in transgenic zebrafish. Materials and Methods mRNA Expression in Japanese Flounder Tissues GCTGGAGAAAG TCGTCTTGG GGATACCTCTCAACTCTG CC GCA GGAGCCACCAGTCAAAA GGTCCAGTG TTCATCATCGT ACTCCGTCGCACAATGCAGA CTGCA ATTTCCATCTCCAGC CCCTATGAACTGTAACAGTTTG GTCAGGTACTTAACCCTCAT TTTCCCT CCATTGTTGGTCG GCGACTCTCAGCTC GTTGTA Identification of 5′ Flanking Region Sequences Katagiri et al., 2000 Hikima et al. (2001) Construction of Promoter-EGFP Plasmid The reporter gene vector pEGFP-1 (Clontech) was used for the construct. Four different Japanese flounder promoters including 5′ untranslated region (UTR) were amplified by specific PCR primers and inserted into the multiple cloning site of pEGFP-1. GFP reporter gene was the endogenous initiation codon directly replaced with that of GFP. To confirm the sequence and direction of insert, the recombinant plasmid was sequenced using a Thermo Sequenase II kit and automated DNA sequencer 373A with a primer designed for pEGFP-1. Production of Transgenic Zebrafish Danio rerio Escherichia coli 1 LPS Treatment of TNF-GFP Transgenic Zebrafish Embryo 2 2 Detection of GFP Gene Expression in Adult Transgenic Zebrafish by RT-PCR GGTCG AGCTGGACGGCGACG ACGAACTCC AGCAGGACCAT TTTCCCTCCATT GTTGGTCG GCGACTCTCAGCTCG TTGTA Results and Discussion 1 Fig. 1. Expression of Japanese flounder tissue-specific genes in different tissues. Messenger RNA expression of complement component C3, gelatinase B, keratin, and TNF genes in spleen, fin, liver, head kidney, post kidney, skin, blood, heart, intestine, ovary, gills, leukocyte, and PBLs stimulated with LPS from Japanese flounder were detected by RT-PCR.  2 Fig. 2. A B C D  1 2 2 1 2 2 3 7 Abelseth et al., 2003 1 Fig. 3. A B 2  4 7 1 Fig. 4. A B C D E F  5 1 Gong et al., 2002 Fig. 5. 2 A B C  6 7 Hirono et al., 2000 Fig. 6. A B 2 C D  Fig. 7. Detection of mRNA expression of GFP gene in fin, skin, liver, kidney, muscle, and brain from adult transgenic zebrafish by RT-PCR. GFP expression regulated by TNF promoter was not detected. N.C. indicates negative control.  In this study we showed that heterologous promoters derived from Japanese flounder worked in transgenic zebrafish. However, the expression patterns different from endogenous Japanese flounder expression patterns. Notably, the keratin and TNF promoters seemed to work faithfully in zebrafish embryos, but the gelatinase B promoter result differed from the results predicted from Japanese flounder. This may have been due to the short 5′ flanking region used in this study. Furthermore, we only observed the GFP expression pattern in a single transgenic line. Whether this GFP expression pattern is representative of gelatinase B promoter activity needs to confirmed in future studies by establishing multiple transgenic lines. Similarly, the fate of these promoters in Japanese flounder needs to be determined by production of transgenic lines of Japanese flounder. The Japanese flounder promoters developed in this study can be adapted for transgenic fish in a variety of situations. Keratin promoter induced expression in epithelial tissues, where it acts as a first line of defense against bacterial infection. It is possible to generate disease-resistant transgenic fish expressing an antibacterial or antiviral peptide only in epithelial tissues. Moreover, using the Japanese flounder TNF promoter, it is possible to generate transgenic fish expressing an antibacterial or antiviral peptide only in cases of infection with pathogens. Thus these promoters should be useful for production of disease-resistant transgenic fish. The overexpression of a foreign gene, especially the gene for an antimicrobial peptide, may suppress growth or maturity of the host fish. In addition, these transgenic fish are safe for human consumption, as the foreign gene is not expressed in the muscle. The Japanese flounder TNF gene promoter can also be used to monitor bacterial infection in live fish using GFP as an indicator. Furthermore, these transgenic zebrafish were suitable for developmental analysis of specific tissues or organs. It is possible to observe development of liver, gills, and skin in living embryos using GFP expression. Yazawa et al., 2005