Introduction 1991 1991 1994 1997 2005 2006 1992 1997 1999 2002 1997 1997 2000 2005a 2005 2000 2000 2005b 2004 2002 2004 2003 2002 2004 Spheroides nephelus Danio rerio Oncorhynchus mykiss 1999 2001 2002 2001 2001 2001 2001 2001 Herein is described a novel set of IgSF receptors present in the channel catfish, and possibly other teleosts, that are composed of Ig domains related to functionally diverse immunoreceptor families present in mammals. Detailed sequence analysis supports that individual catfish leukocyte immune-type receptors (IpLITRs) contain a unique composition of Ig C2-like domains sharing homology with both FcRs and receptors encoded within the LRC. Thus, IpLITRs provide further evidence supporting the common evolutionary origins of genomically and functionally distinct immunoregulatory receptor families present in mammals. Materials and methods Experimental animals and cell lines 1992 1994a 3 1994a b 1997 1999 1994b 2000 2004 1980 Channel catfish LITRs and sequence analysis 2004 1997 1994b 1997 2001 1990 2004 2004 2000 http://psc.edu/biomed/genedoc Southern and Northern blot analyses 2005 1 32 Table 1 IpLITR PCR primers used for generating Ig domain-specific probes and gene-specific primers used in RT-PCR experiments Primer     IpLITR1 D1 Forward 5′ GTCGGACAAGGTCAAGTTCTG 3′ Reverse 5′ GGCTTTTGGTCTCTCTATCAC 3′ IpLITR1 D4 Forward 5′ AATCCTGATGAACAGGTGTACC 3′ Reverse 5′ GTGTTTACAGTGGTAGAAACC 3′ IpLITR2 D3 Forward 5′ AGTCGTGAAGGAGCTGTACTGA 3′ Reverse 5′ TTCACTGCCAGAATGATGGTCAC 3′ IpLITR3 D6 Forward 5′ CTGAGGGACATCCTCTGACCTT 3′ Reverse 5′ GTGTTTACAGTGGTAGAAACC 3′ IpLITR1 GSP Forward 5′ GTCGGACAAGGTCAAGTTCTG 3′ Reverse 5′ CTGCAGACATGATGAACTTCT 3′ IpLITR2 GSP Forward 5′ GTCGGACAAGCTCAAGAGTTT 3′ Reverse 5′ TGTGTAGTAGAGTGGGTTTCC 3′ IpLITR3 GSP Forward 5′ GTCGGACAAGGTCAAGTTCTG 3′ Reverse 5′ GCTTTTGGGTGACTCTCCTCT 3′ IpEF1α GSP Forward 5′ GACTGCCACACTGCTCACATTG 3′ Reverse 5′ TTAGTTACTCAGCAGCTTTCTTCC GSP Total RNA from catfish PBL and various tissues was prepared using RNA-Bee (Tel-test, Friendswood, TX, USA); 10 μg of each sample were electrophoresed on 1.5% formaldehyde-agarose gels and transferred by capillary action onto Hybond-N+ (Amersham Pharmacia Biotech), hybridized, and washed as above. Reverse transcription (RT)-PCR 1 ® Results Catfish LITR sequences 1 1 1 1 1999 2000 2002 2001 1 1 Fig. 1 a b SP Ig asterisks gray shaded a b underlined boxed bracket shaded black c 2001 scale bar boxes ballpoint lines  IpLITRs belong to polymorphic and polygenic gene families 2 2 2 2 2 Fig. 2 a b c d a i b′ e′ h′  Table 2 Identification of IpLITR-like genes in the zebrafish genome Accession numbers Chromosome BX005156 8 BX000524 8 BX511176 3 BX649627 3 CAAK01000490.1 7 Search (04/05) of the zebrafish whole genome shotgun database of the NCBI (Sanger Genomic Institute) IpLITR expression 3 3 3 3 Fig. 3 a b left margin arrows c right margin left margin  4 3 4 Fig. 4 a right margin left margin b boxed arrows a hatched boxes white boxes 1  4 Homology between IpLITRs, LRC, and FcR genes −7 3 Xenopus 3 Table 3 Representative IpLITR BLASTP results Receptor   Accession Score E-value Chromosome IpLITR1 CD22 Human NP_001762 88 4e-16 19q13.1 XFL1.4 Xenopus AAQ56585 84 5e-15 ? CEACAM5 Human CAA34474 84 5e-15 19q13.1 PIRA1 Rat AAD50905 73 1e-11 ? LILRA2 (ILT1) Chimpanzee NP_001009044 72 2e-11 19 FCRL5 (FcRH5) Mouse NP_899045 71 6e-11 3 XFL1.3 Xenopus AAQ63874 71 6e-11 ? LILRA2 (ILT1) Human AAD50364 70 1e-10 19q13.4 KIR3DL1 Human AAC83928 69 3e-10 19q13.4 KIR Chimpanzee AAF86243 68 4e-10 19 CHIRA2 Chicken CAG33731 66 1e-9 ? KIR3DL1 Orangutan AAM78465 66 1e-9 19 FCRL5 (FcRH5) Human CAH71428 66 2e-9 1q21 KIR3DS1 Human AAV32446 66 2e-9 19q13.4 FcγRIIB Rat AAL29888 63 1e-8 13q24 XFL1.6 Xenopus AAQ63873 63 1e-8 ? XFL1.2 Xenopus AAQ56587 62 2e-8 ? CHIRB3 Chicken CAG25957 62 3e-8 ? LILRA3 (ILT6) Human AAB87661 60 8e-8 19q13.4 LIR Bovine XP_586587 60 1e-7 ? PIRA2 Mouse AAC53213 59 2e-7 7 IpLITR2 IRTA2 Bovine XP_595289 76 1e-12 ? FcγRII Guinea pig A34636 61 3e-8 ? FCRL5 (FcRH5) Mouse NP_899045 60 6e-8 3 FCRL3 (FcRH3) Mouse AAS91578 60 6e-8 3 FcγRI Macaque AAL92095 59 1e-7 ? FCRL5 (FcRH5) Human NP_112571 57 4e-7 1q21 FcγRIα Human CAI12557 57 5e-7 1q21 FcγRIIB Mouse AAH19758 56 9e-7 1 XFL1.4 Xenopus AAQ56585 56 9e-7 ? IRTA1 Bovine XP_614632 55 2e-6 ? FcεRIα Human AAH05912 53 8e-6 1q23 FREB2 Human AAX11390 53 8e-6 1q23.3 FcγRI Human AAA58414 53 8e-6 1q21.2 Similarity search (BLASTP) of the NCBI’s nonredundant protein database using the four Ig domains of IpLITR1 and the three Ig domains of IpLITR2 CEACAM5 XFL Xenopus Phylogenetic analyses and alignments 5 5 5 Fig. 5 gray shading a b c 2001 scale bars  6 6 6 6 6 Fig. 6 a 5 Gray shading Boxed residues Black gray arrows Hatched boxes dashes b gray shaded 5 2001 scale bars c Gray shading black gray arrows “dotted” lines hatched boxes dashes  −8 −7 2 7 7 7 7 7 Fig. 7 a 2004 1997 2001 b Hatched bars solid black lines gray boxes dashed box  Discussion The novel IpLITRs described herein represent a polymorphic and polygenic gene complex that are primarily expressed in hematopoietic tissues. The polymorphic nature of this gene complex was indicated by RFLP analysis, which revealed differences in where various restriction enzymes cut the genomic DNA among the sibling catfish. However, it should be noted that only detailed sequence analyses of these IpLITR genes in a number of individuals would be required to determine if any polymorphic differences are also found within the coding regions. In addition, segregation analyses suggested that IpLITR genes are encoded within multiple independently segregating but homologous loci, similar to the situation seen with the ZfLITR homologs identified by genome mining. These paralagous relationships strongly suggest that IpLITRs are products of multiple gene duplication and translocation events from a common ancestoral gene. Whether or not the receptors encoded by the different IpLITR loci are functionally redundant remains to be determined. However, IpLITRs are related to functionally and genomically distinct mammalian FcRs and LRC encoded receptors, suggesting that such paralogous loci could have evolved to give rise to an array of immunoregulatory receptors with different functions. The coordinate expression of IpLITRs by myeloid and lymphoid cell lines in combination with their potential activating and inhibitory signaling capabilities suggests that they play an important role in immune cell function(s). This possible importance of IpLITRs in immune responses is highlighted by the RT-PCR expression studies where a large number of highly related, but unique, IpLITR sequences were identified. These variant IpLITR sequences differed in the number of Ig domains present, and in some cases in the length of the CYT. Therefore, in addition to the prototype IpLITR1, IpLITR2, and IpLITR3 described here, other IpLITR family members are coexpressed by catfish myeloid and lymphoid cells. Whether or not some of the variously sized transcripts represent messages from different IpLITR genes or are the result of alternative splicing is unknown. However, the large number of unique IpLITRs found expressed suggests that IpLITRs represent a complex immune receptor family that can potentially generate a large number of IpLITR types. The prototypical IpLITR1, IpLITR2, and IpLITR3 encode receptors with four, three, and six Ig domains, respectively. Pairwise comparisons and phylogenetic analysis of these domains suggest a high degree of conservation and a conserved membrane distal to membrane proximal ordering. Each of these three receptors has very similar D1 and D2 sequences, and IpLITR1 and IpLITR3 have almost identical D3 and D4s. However, variation does occur between predicted membrane proximal Ig domains. The IpLITR2 D3 sequence is unique to this receptor and IpLITR3 D5 and D6 are not similar to any other of the prototypical IpLITR Ig domain sequences. Identification of LITR-like sequences on different zebrafish chromosomes and comparisons with IpLITRs supports the notion that these polymorphic and polygenic immune receptors are not unique to catfish. Like IpLITRs, the predicted ZfLITRs are also composed of unique combinations of Ig domains. Such differences in the Ig domain compositions of IpLITRs and ZfLITRs may influence their ligand binding capabilities, formation of homo- or heterodimers and overall immunomodulatory functions. 1999 2000 2002 2003 2003a b 2006 1999 2001 1997 1997 2000 2005a Xenopus 2005b 1986 2003 2004 2001 2001 2002 2002 2001 2001 2002 2001 2005 2 2005 In summary, the discovery of individual catfish receptors that encode Ig domains related to both FcR and LRC gene families provides further support for the common origin of these important mammalian immune receptors. Identification of LITR-like sequences in the zebrafish genome also demonstrates that these receptors are likely found in all teleosts. Annotation of these genomic segments will be necessary to determine if zebrafish LITR homologs exhibit conserved genomic features and syntenic genomic location with mammalian 1q21-23 and/or 19q13. Thus, the discovery of IpLITRs is an important step towards further understanding the common origin and evolutionary history of the different families of mammalian immunoregulatory receptors. The investigation of the functional significance of these novel teleost receptors is underway and will be aided by the availability of channel catfish cell lines that coordinately express IpLITRs and the eventual production of IpLITR specific antibodies. Electronic supplementary material Below is the link to the electronic supplementary material.
 Electronic Supplementary Figure 1 52 kb