Introduction 2001 1991 2001 2002 2003 2001 2006 2005 2005 2002 2004 2001 2004 2004 2003 2001 2007 2006 2006 Materials and methods Donors n n 2 1 Table 1 BMI THS ASC Res T-LS ND Donor Age (years) 2 THS Procedure ASC yield (%) 1 02-0001 62 22.6 Abdomen Res 9.20 2 03-0007 26 24.4 Abdomen T-LS 8.50 3 03-0018 42 23.9 Abdomen Res 12.50 4 03-0021 57 29.6 Abdomen Res 4.40 5 04-0003 37 ND Abdomen T-LS 2.20 6 04-0013 36 28.1 Abdomen Res 2.20 7 04-0015 37 26.9 Abdomen Res 0.93 8 05-0004 39 ND Abdomen T-LS 1.50 9 05-0007 42 28.3 Abdomen T-LS 8.30 10 06-0003 50 26.5 Abdomen T-LS 3.6 11 06-0006 42 24.2 Abdomen T-LS 4.8 12 06-0007 46 30.5 Abdomen T-LS 9.7 13 03-0010 24 24.4 Hip/thigh T-LS 0.30 14 04-0004 40 ND Hip/thigh T-LS 0.82 15 04-0008 27 26.6 Hip/thigh T-LS 0.16 16 04-0009 36 ND Hip/thigh T-LS 0.16 17 05-0005 34 22.2 Hip/thigh T-LS 0.60 18 05-0006 28 23.2 Hip/thigh T-LS 0.21 19 05-0008 43 24.6 Hip/thigh T-LS 7.20 20 06-0005 33 23.2 Hip/thigh T-LS 0.10 21 06-0010 52 26.2 Hip/thigh T-LS 2.70 22 06-0012 42 23.7 Hip/thigh T-LS 0.16 Cell isolation and storage 2006 6 Limiting dilution assay 3 CFU assays n n 4 3 For the CFU-fibroblast (CFU-F) assay, the fixation time was 11–14 days, depending on the amount and growth kinetics of the colonies (merging of colonies was avoided). At the appropriate time point, the medium was removed, and the cells were washed with phosphate-buffered saline (PBS), fixed with 4% formaldehyde for 10 min, and subsequently colored in a 0.2% toluidine blue solution in borax buffer for about 1 min. Excess stain was washed off with distilled water, and colonies were counted. Cells of the duplicate 6-well plate were submitted to a CFU-alkaline phosphatase (CFU-ALP) assay. Cultures were performed in normal medium for 7 days in order to obtain colonies and to remove contaminating cells, after which osteogenic medium was added for 2 weeks. Following this period, cells in the CFU-ALP plate were rinsed with PBS, fixed in 4% formaldehyde, and incubated for 10 min in a 0.2 M TRIS-hydrochloride (pH 10), 0.2 M calcium chloride, 0.1 M magnesium chloride solution, whereafter a solution containing 0.2 M TRIS-hydrochloride (pH 10), 0.2 M calcium chloride, 0.1 M magnesium chloride, and 600 μl nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate was added for 30 min. The percentage of the colonies staining positive for ALP was determined. Culturing of SVF cells 6 2 2 Growth kinetics of ASCs 5 \documentclass[12pt]{minimal}
\usepackage{amsmath}
\usepackage{wasysym} 
\usepackage{amsfonts} 
\usepackage{amssymb} 
\usepackage{amsbsy}
\usepackage{mathrsfs}
\usepackage{upgreek}
\setlength{\oddsidemargin}{-69pt}
\begin{document}$$ Population\;Doubling\;Time = \;\frac{{Days\;in\;\exp onential\;phase}} {{{{\left( {\log \;N2 - \log \;N1} \right)}} \mathord{\left/  {\vphantom {{{\left( {\log \;N2 - \log \;N1} \right)}} {\log \;2}}} \right.  \kern-\nulldelimiterspace} {\log \;2}}} $$\end{document} N N Flow cytometry 2007 Chondrogenic and osteogenic differentiation n n 2006 6 1 1 2 2 (Immuno)histochemistry 2006 2007 Spectrophotometric ALP activity 1997 1955 Real-time polymerase chain reaction 2006 plus 2 Table 2 18 S AGG COL1αI COL2B COL10a1 OPN RUNX-2 Gene Primer sets Accession number, product length (bp) 18 S Forward: 5′ GTAACCCGTTGAACCCCATT− 3′ Human, NM_10098, 151 bp Reverse: 5′ CCATCCAATCGGTAGTAGCG 3′ AGG Forward: 5′CAACTACCCGGCCATCC 3′ Human, NM_001135, 160 bp Reverse: 5′GATGGCTCTGTAATGGAACAC 3′ COL1αI Forward: 5′ AAGCCGAATTCCTGGTCT 3′ Human, NM_000088, 195 bp Reverse: 5′ TCCAACGAGATCGAGATCC 3′ COL2B Forward: 5′ AGGGCCAGGATGTCCGGCA 3′ Human, NM_033150, 195 bp Reverse: 5′ GGGTCCCAGGTTCTCCATCT 3′ COL10a1 Forward: 5′ CACTACCCAACACCAAGACA 3′ Human, NM_000493, 225 bp Reverse: 5′ CTGGTTTCCCTACAGCTGAT′ OPN Forward: 5′ TTCCAAGTAAGTCCAACGAAAG 3′ Human, AF_052124, 181 bp Reverse: 5′ GTGACCAGTTCATGAGATTCAT 3′ RUNX-2 Forward: 5′ ATGCTTCATTCGCCTCAC 3′ Human, NM_001024630, 156 bp Reverse: 5′ ACTGCTTGCAGCCTTAAAT 3′ Real-time PCR data analysis With the Light Cycler software (version 4), the crossing points were assessed and plotted versus the serial dilution of known concentrations of the standards derived from each gene by the Fit Points method. PCR efficiency was calculated by Light Cycler software, and the data were used only if the calculated PCR efficiency was between 1.85–2.0. Statistics t r −2 Results Effects of tissue-harvesting site on frequency of ASCs 2006 1 1 P Fig. 1 ASCs SVF a LD b CFU-F c P a P b P c P  Effect of tissue-harvesting site on frequency of CFUs having osteogenic differentiation potential 1 2 P Fig. 2 CFU-ALP CFU-F  Phenotypic characterization and growth kinetics of cultured ASCs 3 Table 3 − + ++ +++ Cell-surface marker n CD29 ++ CD31 – CD34 + CD45 – CD54 ++ CD90 +++ CD105 ++ CD106 – CD146 – CD166 + HLA-ABC ++ HLA-DR – 3 3 Fig. 3 a b c P t  Effect of tissue-harvesting site on osteogenic differentiation potential of ASCs P P 4 4 Fig. 4 a–c RUNX-2 P COL1α1 P OPN P d d stim con P e–g e f g black spots  P 4 4 4 4 Effect of tissue-harvesting site on chondrogenic differentiation potential of ASCs n n 5 P P 5 Fig. 5 a lane 1 lane 2 lane 3 b c AGG P Col10a P d d f e  5 5 5 Discussion In this study, we have investigated whether the yield and functional characteristics of ASCs are affected by the adipose tissue-harvesting site, i.e., abdomen and hip/thigh regions. We have found a difference in the frequency of ASCs between adipose tissue harvested from the abdomen and the hip/thigh regions. SVF isolates derived from abdominal fat contain significantly higher frequencies of ASCs. When cultured, the growth kinetics and surface-marker expression of ASCs from both tissue-harvesting sites are similar. We have detected no differences in osteogenic or chondrogenic differentiation potential between these cultured ASCs from the two tissue-harvesting sites. 1991 2003 2004 1988 1997 1994 2003 2002 1995 P r P r 1991 2003 2004 1997 1995 2003 2005 2006 2005 1 2000 8 2004 2003 2006 2001 6 2002 2006 2003 2006 8 2002 6 2000 1 2 2006 2006 1988 1985 1981 2001 2004 2006 2007 2007 1 3 The homogeneous ASC population has been induced to the osteogenic and chondrogenic lineages. Having determined the osteogenic differentiation capacity of ASCs, we have shown significant up-regulation of osteogenic gene expression, ALP activity, and matrix mineralization. Interestingly, although no significant difference has been detected in ALP activity between ASCs from the abdomen and hip/thigh regions, ASCs from the hip/thigh region tend to show higher values of ALP activity after induction. This might be related to the underlying bone tissue, thereby implying that the ASCs of the hip/thigh region are less multipotent and more committed to the osteogenic lineage. 2004 2003 2002 2006 2006 2006 1991 1991 2000 2006 2000 1983 2006 2000 We therefore conclude that the yield of ASCs is dependent on the tissue-harvesting site. In planning the optimal one-stage procedure for the regeneration of cartilage tissue, factors that can positively influence the outcome of the operation must be taken into account. In view of this, the abdomen seems to be preferable to the hip/thigh region for harvesting ASCs.