Introduction 1 4 5 6 7 8 9 10 12 13 10 Materials and methods Culture and clone expansion of MAPCs 6 2 2 −9 −4 3 2 Total RNA isolation and RT-PCR analysis N d 1 Table 1 14 16 Genes Primers(5’-3’) Product size(bp) Location Layer Oct-4 Forward: CGCCAGAAGGGGAAAAGA Reverse: CAGGAAAAGGGACCGAGTAG 176     CYP 51 Forward:ATCCTGACCGCTACCTACA Reverse: GGCTTCCCTGAAATCCTA 461 Liver Endoderm SM22α : 279 Muscle Mesoderm NMDA Forward: TGAGCCCACCAGAAAAGG Reverse: ACTGCTTTGCCCTCCACC 625 Brain Ectoderm GATA-4 Forward: TCCCCACAAGGCTATCCA Reverse: CCGAAGAAGGTCACGAGGT 321 Heart Mesoderm 18S Forward: CAAGAACGAAAGTCGGAGGTTCG Reverse: TTATTGCTCAATCTCGGGTGGCTG 460     Immunocytofluorescence and fluorescence-activated cell sorter analysis Clonal cultured MAPCs were fixed with 4% paraformaldehyde for 4 min at room temperature. After being blocked with phosphate-buffered saline (PBS) containing 2% BSA, cells were permeabilized with 0.1%Triton-X100 for 10 min. Slides were incubated sequentially overnight at 4°C with the following primary antibodies: CD71 (1:50, Santa Cruz, USA), Vimentin (1:200, DAKO, USA), α-SMA (1:200, Boster Biotechnology, China), and SSEA-1(1:50, Santa Cruz, USA); then cells were incubated for 40 min at room temperature with fluorescein isothiocyanate (FITC) or Cy3-coupled IgG secondary antibody (1:500, Jackson), stained with DAPI (Sigma–Aldrich), and observed under a fluorescence microscope (BX41TB, Olympus, Japan). For fluorescence-activated cell sorter (FACS) analysis, cells pelleted were incubated on ice for 30 min with FITC- or PE-conjugated monoclonal antibodies against CD34, CD44, CD45 (Becton–Dickinson, CA), and MHC-I (Abcam, UK). After two washes with cold PBS, the labeled cells were analyzed by a FACStar flow cytometer (Becton Dickinson, CA, USA). In vitro differentiation of MAPCs To induce differentiation, clonal cultured MAPCs were cultured in the media containing no FCS, EGF, PDGF-BB, or LIF unless otherwise indicated. All the experiments were repeated at least three times. Adipogenic differentiation of MAPCs 4 2 Osteogenic differentiation of MAPCs 4 2 –8 −4  −3  Neuroectodermal differentiation of MAPCs 4 2 Hepatocyte differentiation of MAPCs 4 2 Results Stable in vitro proliferation and expansion of clonal cultured MAPCs 1 1 1 Fig. 1 a d3 d10 P0 P4 d3 b D2 D4 D8  1 2 1 ) Expression of Oct4 and genes of three germ layers in single cell-derived MAPCs 2 2 Fig. 2 a b NEG POS n  Identification of molecular markers in single cell-derived P20 MAPCs-10D# 3 Fig. 3 a b  3 Differentiation potential of single cell-derived P20 MAPCs-10D# into three somatic germ layers consisting of osteoblasts, adipocytes, neurons, and hepatocytes 4 4 4 4 4 4 4 4 4 Fig. 4 a 1 2 3 b 1 2 3 c . 1 2 3  Discussion 17 18 19 10 12 20 21 2 16 22 23 2 20 24 14 25 26 16